Citation: Sosa, L.; Espinoza, L.C.; Valarezo, E.; Bozal, N.; Calpena, A.; Fábrega, M.-J.; Baldomà, L.; Rincón, M.; Mallandrich, M. Therapeutic Applications of Essential Oils from Native and Cultivated Ecuadorian Plants: Cutaneous Candidiasis and Dermal Anti-Inflammatory Activity. Molecules 2023, 28, 5903. https:// doi.org/10.3390/molecules28155903 Academic Editors: Arunaksharan Narayanankutty, Ademola C. Famurewa and Eliza Oprea Received: 15 July 2023 Revised: 28 July 2023 Accepted: 29 July 2023 Published: 5 August 2023 Copyright: © 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). molecules Article Therapeutic Applications of Essential Oils from Native and Cultivated Ecuadorian Plants: Cutaneous Candidiasis and Dermal Anti-Inflammatory Activity Lilian Sosa 1,2, Lupe Carolina Espinoza 3,4 , Eduardo Valarezo 3 , Núria Bozal 5 , Ana Calpena 4,6 , María-José Fábrega 7 , Laura Baldomà 8 , María Rincón 9 and Mireia Mallandrich 4,6,* 1 Microbiological Research Institute (IIM), National Autonomous University of Honduras (UNAH), Tegucigalpa 11101, Honduras; lilian.sosa@unah.edu.hn 2 Research Institute of Applied Sciences and Technology, National Autonomous University of Honduras (UNAH), Tegucigalpa 11101, Honduras 3 Departamento de Química, Universidad Técnica Particular de Loja, Loja 1101608, Ecuador; lcespinoza@utpl.edu.ec (L.C.E.); bevalarezo@utpl.edu.ec (E.V.) 4 Institut de Nanociència i Nanotecnologia (IN2UB), Universitat de Barcelona (UB), 08028 Barcelona, Spain; anacalpena@ub.edu 5 Departament de Biologia, Sanitat i Medi Ambient, Facultat de Farmàcia i Ciències de l’Alimentació, Universitat de Barcelona (UB), 08028 Barcelona, Spain; nuriabozaldefebrer@ub.edu 6 Departament Farmàcia, Tecnologia Farmacèutica, i Físicoquímica, Facultat de Farmàcia i Ciències de l’Alimentació, Universitat de Barcelona (UB), 08028 Barcelona, Spain 7 Department of Experimental and Health Sciences, Parc of Biomedical Research of Barcelona, Pompeu Fabra University, 08003 Barcelona, Spain; mjfabrega.f@gmail.com 8 Departament de Bioquímica i Fisiologia, Facultat de Farmàcia i Ciències de l’Alimentació, Universitat de Barcelona (UB), 08028 Barcelona, Spain; lbaldoma@ub.edu 9 Departament de Ciència de Materials i Química Física, Facultat de Química, Universitat de Barcelona (UB), 08028 Barcelona, Spain; m.rincon@ub.edu * Correspondence: mireia.mallandrich@ub.edu Abstract: Essential oils are a complex mixture of aromatic substances whose pharmacological actions, including antimicrobial, antioxidant, anticancer, and anti-inflammatory activities, have been widely reported. This study aimed to evaluate the anti-Candida and dermal anti-inflammatory activity of essential oils from native and cultivated Ecuadorian plants. Essential oils from Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris were isolated by hydrodistilla- tion and were characterized physically and chemically. Its tolerance was analyzed by in vitro and in vivo studies. The antifungal activity was studied against Candida albicans, Candida glabrata, and Candida parapsilosis, whereas the anti-inflammatory effect was evaluated by a mouse ear edema model. The main compounds were limonene, α-phellandrene, (E)-methyl cinnamate, and 1,8-cineole, respectively. All essential oils showed high tolerability for skin application, antifungal activity against the three Candida strains, and anti-inflammatory efficacy by decreasing edema and overexpression of pro-inflammatory cytokines. Dacryodes peruviana essential oil showed the highest antifungal activity. On the other hand, Dacryodes peruviana and Melaleuca armillaris showed the greatest anti-inflammatory potential, decreasing edema by 53.3% and 65.25%, respectively, and inhibiting the overexpression of TNF-α, IL-8, IL-17A, and IL-23. The results suggest that these essential oils could be used as alternative therapies in the treatment of both cutaneous candidiasis and dermal inflammation. Keywords: Candida albicans; Candida glabrata; Candida parapsilosis; skin inflammation; essential oil; Bursera graveolens; Dacryodes peruviana; Mespilodaphne quixos; Melaleuca armillaris Molecules 2023, 28, 5903. https://doi.org/10.3390/molecules28155903 https://www.mdpi.com/journal/molecules Molecules 2023, 28, 5903 2 of 18 1. Introduction Fungal infections represent a public health problem affecting almost one billion people worldwide. These infections appear in different anatomical sites such as the skin, nails, scalp, and vagina [1]. The skin is the largest organ in the body and can suffer from fungal infections such as candidiasis. Cutaneous candidiasis is a superficial form of mycosis caused by the proliferation of Candida spp. fungi in the skin, especially in intertriginous areas causing itching, erosion, inflammation, and pustules [2,3]. Candida albicans is the species that produces most of the cases of candidiasis. However, in America and Europe (except for Spain), the cases have increased due to the appearance of Candida glabrata, while in South America, Japan, and Spain, Candida parapsilosis has been the main cause of candidiasis [4]. The clinical importance of non-albicans strains lies in infections caused by strains such as Candida glabrata. The incidence of this strain is high in patients with acquired immunodeficiency syndrome (AIDS), cancer, and diabetes and in those who use medical devices. Likewise, it has been reported as a fungus resistant to azoles (first-line treatment), with a faster propagation than Candida albicans and a higher mortality rate [5,6]. In the case of infections caused by Candida parapsilosis, this strain is responsible for a third of neonatal Candida infections reaching a mortality rate of approximately 10%. In addition, patients who require prolonged use of a central venous catheter are also at increased risk of infection due to the innate ability of this fungus to adhere to prosthetic surfaces and implanted medical devices due to the biofilm they produce. The structure of this biofilm shows high variability in different clinical isolates of Candida parapsilosis [7]. The treatments used for dermal candidiasis consist of the use of topical azoles that inhibit the biosynthesis of the ergosterol component of the cell membrane and some macrolides such as nystatin and amphotericin B, which bind to the ergosterol of the mem- brane to induce porosity and cause cell death through leakage of cytosolic components [8]. Likewise, drugs such as caspofungin have been reported in the literature as possible thera- peutic alternatives. This drug inhibits fungal cell membrane formation by disrupting the synthesis of the structural component 1,3-β-d-glucan [9]. Despite advances in antifungal treatments, many patients frequently experience complications related to hepatoxicity and increased fungal resistance to conventional drugs [10]. Inflammation is the response of an organism to tissue damage caused by a foreign agent that can be physical, chemical, or biological [11]. When an inflammatory process is generated, macrophages are activated, which produce pro-inflammatory mediators such as prostaglandins, cyclooxygenases, reactive oxygen species, and cytokines [12]. Tumor necrosis factor alpha (TNF-α), interleukin (IL)-8, IL-17A, and IL-23 are cytokines secreted rapidly in response to an inflammatory process. An inappropriate or excessive inflamma- tory response in the skin can trigger chronic inflammation causing skin disorders such as dermatitis, psoriasis, and rosacea [13]. TNF-α is produced during acute inflammation by macrophages/monocytes, and it induces the expression of pro-inflammatory mediators such as IL-6, IL-8, and IL-1β [14]. IL-8 is a member of the chemokine family that attracts neutrophils, basophils, and T-cells to sites of inflammation and is released from different cells, including monocytes, macrophages, neutrophils, fibroblasts, endothelial cells, and keratinocytes [15]. IL-17A is produced by a subset of activated CD4 T cells, and it is as- sociated with allergic processes and autoimmune diseases including psoriasis, and turn, increases the levels of IL-6 and IL-8 [16]. IL-23 is a dimeric cytokine that promotes the devel- opment and differentiation of effector Th17 cells, and thus, it has been implicated in chronic immune-inflammatory disorders such as arthritis, colitis, gastritis, and psoriasis [17]. Nonsteroidal anti-inflammatory drugs (NSAIDs), including diclofenac, fenoprofen, ibuprofen, ketoprofen, ketorolac, and naproxen, are one of the most widely used groups of drugs for treating inflammation, pain, and fever. However, these drugs have been associated with adverse gastrointestinal, renal, hepatic, and skin reactions [18,19]. In the search for effective compounds and alternative therapies to treat cutaneous candidiasis and dermal inflammation, natural products, especially essential oils, stand out as promising candidates in antifungal and anti-inflammatory treatments [20]. Molecules 2023, 28, 5903 3 of 18 An essential oil (EO) is a complex mixture of aromatic substances isolated from diverse types of aromatic plants. Various scientific studies have reported numerous phar- macological actions for essential oils, including antimicrobial, antioxidant, anticancer, and anti-inflammatory properties [21]. Essential oils are used in the pharmaceutical, cosmetic, and food industries [22,23]. Burseraceae is a family of 18 genera and about 650 species [24]. A total of 40 species of this family have been reported in the megadiverse country of Ecuador [25]. Some studies show that the fruits of Burseraceae species contain a high yield (2–5%) of essential oil [26]. Bursera graveolens (Kunth) Triana and Planch is a shrub or tree commonly known as “palo santo” that grows in dry forests of tropical America and on the Pacific coast of South America, especially in Colombia, Costa Rica, El Salvador, Ecuador, Guatemala, Honduras, Mexico, Nicaragua, and Peru. In Ecuador, B. graveolens can mainly be found in the provinces of Galapagos, Guayas, Imbabura, Loja, and Manabí [25]. Essential oil of B. graveolens can be found in its leaves, trunk, and fruits and has shown acaricidal, antimicrobial, antioxidant, and repellent activities [26,27]. Dacryodes peruviana (Loes.) H.J. Lam (Burseraceae) is a tree of the Burseraceae family known as “copal”, which grows in the humid forests of Colombia, Peru, Ecuador, and Venezuela [28]. In Ecuador, D. peruviana has the status of native and is widely distributed in the Amazonian and Andean Ecuadorian regions between 0 and 2500 m above sea level [25]. The essential oil of copal fruits has shown antimicrobial and repellent activity [29]. Lauraceae comprises approximately 2978 accepted species in nearly 68 genera world- wide [30]. Within this family, the Mespilodaphne is a small genus with 15 individuals [31]. Mespilodaphne quixos (Lam.) Rohwer (Syn. Ocotea quixos (Lam.,) Kosterm, accepted name Mespilodaphne quixos and validated name Ocotea quixos) [32] is an Ecuadorian native and cultivated aromatic species, widely distributed in the Andean and Amazonian regions between 0 and 1000 m above sea level [33]. The species is commonly known as “ishpingo” or “canela” because it smells similar to cinnamon (“canela” in Spanish). Essential oil of this species has been isolated from its leaves, trunk, fruits, and fruit calices and has been shown to have antimicrobial, anti-inflammatory, antioxidant, antithrombotic, and larvicidal activities [34–38]. Myrtaceae is a family of 129 genera and 6233 species distributed in tropical regions worldwide. Myrtaceae is a family of evergreen trees or shrubs rich in essential oils [39]. Melaleuca armillaris (Sol. ex Gaertn.) Sm. is a species of the Myrtaceae family cultivated in Ecuador known by the common name of bracelet honey myrtle or “árbol de papel”. The essential oil of the leaves of M. armillaris has shown antimalarial, antioxidant, anticancer, antimicrobial, and phytotoxic activities [40,41]. Based on these remarkable findings, the purpose of this study was to evaluate the therapeutic applications of essential oils isolated from native and cultivated plants of Ecuador in the treatment of cutaneous candidiasis and dermal inflammation, as well as analyze their skin tolerance, to provide effective and safe alternatives in the treatment of these two pathologies. 2. Results 2.1. Isolation and Physical Properties of Essential Oil The yield in essential oil and physical properties density, refractive index, and optical activity for the four essential oils used are shown in Table 1. The physical properties of an essential oil are used as a quality parameter. The yield of the fruits, in general, is higher than that of the leaves of a species. According to the classification made by Molares et al. in 2009, the yield of Melaleuca armillaris is intermediate (values between 5 mL/kg and 10 mL/kg), and the yields of the other species are high (values greater than 10 mL/kg) [42]. The yield, together with the biomass availability of a species, provides an idea of the amount of essential oil available to scale a project, which makes the essential oil of these species suitable for industrial applications. Molecules 2023, 28, 5903 4 of 18 Table 1. Yield and physical properties of the essential oils from Bursera graveolens (BGR), Dacryodes peruviana (DPE), Mespilodaphne quixos (MQU), and Melaleuca armillaris (MAR). BGR DPE MQU MAR Mean SD Mean SD Mean SD Mean SD Yield (mL/kg) 31 2 45 3 15 1 9 1 Density, ρ (g/cm3) 0.8385 0.0010 0.8456 0.0023 0.8758 0.0013 0.9053 0.0045 Refractive index, n20 1.4760 0.0011 1.4751 0.0002 1.4790 0.0012 1.4641 0.0023 Specific rotation, [α] (◦) 47.7 1.1 12.2 0.7 11.2 0.2 4.3 1.1 2.2. Essential Oil Compounds Identification The identification of volatile compounds contained in Bursera graveolens, Dacryodes peruviana, Ocotea quixos (Accepted name Mespilodaphne quixos), and Melaleuca armillaris essential oils was carried out using gas chromatography equipped with a flame ionization detector and gas chromatography coupled to a mass spectrometer detector using capillary nonpolar column DB-5Ms. The compounds were classified into six groups: monoterpene hydrocarbons (MH), oxygenated monoterpene (OM), sesquiterpene hydrocarbons (SH), oxygenated sesquiterpene (OS), phenylpropanoids, and other compounds (OC) (Table 2). All essential oil compounds from Dacryodes peruviana and most essential oil compounds from Bursera graveolens belong to the MH group. The main compounds were limonene, α- phellandrene, (E)-methyl cinnamate, and 1,8-cineole in the essential oils of Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris, respectively. Table 2. Majority compounds (>1%) of the essential oils from Bursera graveolens (BGR), Dacryodes peruviana (DPE), Mespilodaphne quixos (MQU), and Melaleuca armillaris (MAR). Compounds RIC RIR BGR DPE MQU MAR Type % SD % SD % SD % SD α-Thujene 926 924 - 1.9 0.1 - - MH α-Pinene 932 932 - 8.3 0.3 1.6 0.1 3.6 0.1 MH Sabinene 969 969 - 1.4 0.4 - - MH β-Pinene 973 974 - 2.6 0.9 1.3 0.1 1.4 0.1 MH Myrcene 986 988 1.1 0.4 - - 1.3 0.1 MH α-Phellandrene 1005 1002 35.9 1.3 50.3 3.3 - - MH p-Cymene 1021 1020 - 3.1 0.8 - - MH Limonene 1025 1024 49.4 2.2 23.0 1.5 - - MH 1,8-Cineole 1025 1026 - - 1.3 0.1 83.4 2.5 OM Terpinolene 1082 1086 - 5.2 0.9 - - MH Menthofuran 1159 1159 6.6 1.2 - - - OM α-Terpineol 1187 1186 - - - 8.0 0.1 OM (E)-Cinnamaldehyde 1268 1267 - - 10.0 1.4 - PP α-Copaene 1372 1374 - - 4.5 0.9 - SH (E)-Methyl cinnamate 1376 1376 - - 19.3 1.3 - PP (E)-Caryophyllene 1415 1417 - - 15.8 1.8 - SH 6,9-Guaiadiene 1442 1442 - - 4.5 0.5 - SH (E)-Cinnamyl acetate 1445 1443 - - 12.5 0.7 - PP Germacrene D 1476 1480 1.5 0.1 - - - SH β-Selinene 1489 1489 - - 5.8 0.5 - SH Bicyclogermacrene 1496 1500 - - 4.2 0.4 - SH Anisyl propanoate 1510 1511 - - 2.7 0.4 - OC 7-epi-α-Selinene 1520 1520 - - 2.5 0.3 - SH (E)-γ-Bisabolene 1527 1529 - - 3.1 0.3 - SH Caryophyllene oxide 1580 1582 - - 2.5 0.4 - OS Molecules 2023, 28, 5903 5 of 18 Table 2. Cont. Compounds RIC RIR BGR DPE MQU MAR Type % SD % SD % SD % SD Monoterpene hydrocarbons (MH) 86.4 95.8 3.0 6.2 Oxygenated monoterpene (OM) 6.6 - 1.3 91.4 Sesquiterpene hydrocarbons (SH) 1.5 - 40.4 - Oxygenated sesquiterpene (OS) - - 2.5 - Phenylpropanoids (PP) - - 41.8 Other compounds (OC) - - 2.7 - Total identified 94.6 95.8 91.7 97.6 RIC: calculated retention rates; RIR: reference retention indices, Adams, R.P. (2007) [43]; %: mean percentage obtained from 9 replicates; SD: standard deviation. 2.3. Cytotoxicity Studies by Methylthiazolyldiphenyl-Tetrazolium Bromide (MTT) Method Cell viability of human keratinocytes HaCaT exposed at the different concentrations of the essential oils studied was evaluated by MTT cytotoxicity assay. After 24 h of incubation, it was observed that the essential oils from Bursera graveolens, Dacryodes peruviana, and Melaleuca armillaris at the assayed concentrations from 500 to 5000 µg/mL did not affect cell viability, which was greater to 80% whereas the essential oil from Mespilodaphne quixos (MQU) showed cell viability greater to 80% from 500 to 1000 µg/mL (Figure 1). Therefore, these results suggest that the essential oils do not generate toxicity in the keratinocytes at these concentrations. Molecules 2023, 28, x FOR PEER REVIEW 5 of 19 Anisyl propanoate 1510 1511 - - 2.7 0.4 - OC 7-epi-α-Selinene 1520 1520 - - 2.5 0.3 - SH (E)-γ-Bisabolene 1527 1529 - - 3.1 0.3 - SH Caryophyllene oxide 1580 1582 - - 2.5 0.4 - OS Monoterpene hydrocarbons (MH) 86.4 95.8 3.0 6.2 Oxygenated monoterpene (OM) 6.6 - 1.3 91.4 Sesquiterpene hydrocarbons (SH) 1.5 - 40.4 - Oxygenate sesquiterpene (OS) - - 2.5 - Ph nylpropanoids (PP) - - 1 8 Other compounds (OC) - - 2.7 - Total identified 94.6 95.8 91.7 97.6 RIC: calculated retention rates; RIR: reference retention indices, Adams, R.P. (2007) [43]; CF: Chem- ical Formula; %: mean percentage obtained from 9 replicates; SD: standard deviation. 2.3. Cytotoxicity Studies by Methylthiazolyldiphenyl-Tetrazolium Bromide (MTT) Method ell viability of human keratinocytes HaCaT exposed at the different concentrations of the essential oils studied was evaluated by MTT cytotoxicity assay. After 24 h of i cu- bation, it was observed that the essential oils from Bursera graveolens, Dacryodes per viana, and Melaleuca armillaris at the ass yed concentrations f om 500 to 5000 µg/mL did not af- fect cell viability, which w greater to 80% whereas the essential oil fro Mespil daphne quixos (MQU) s owed cell viability greater to 80% from 500 to 1000 µg/mL (Figure 1). Therefore, th se results suggest ha the essential oils do not generate toxicity in th keratinocytes at th e concentrations. Figure 1. Cytotoxicity of HaCaT cell line exposed to essential oils from Bursera graveolens (BGR), Dacryodes peruviana (DPE), Mespilodaphne quixos (MQU), and Melaleuca armillaris (MAR). 2.4. In Vivo Tolerance Studies by Evaluation of Transepidermal Water Loss (TEWL) Figure 2A shows that Bursera graveolens essential oil did not cause significant differ- ences in TEWL value after topical application on the ventral area of the forearm of the volunteers compared with the basal state, whereas Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris essential oils significantly reduced the TEWL values after 10 min of topical application (Figure 2B–D). However, a tendency to return to the basal states was observed after 2 h of the experiment. Figure 1. Cytotoxicity of HaCaT ce l line exposed to e sential oils from Bursera graveolens (BGR), acryodes peruviana ( ), espiloda e i os ( ), l l ill i ( ). 2.4. In Vivo Tolerance Studies by Evaluation of Transepidermal Water Loss (TEWL) Figure 2A shows that Bursera graveolens essential oil did not cause significant differ- ences in TEWL value after topical application on the ventral area of the forearm of the volunteers compared with the basal state, whereas Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris essential oils significantly reduced the TEWL values after 10 min of topical application (Figure 2B–D). However, a tendency to return to the basal states was observed after 2 h of the experiment. Molecules 2023, 28, 5903 6 of 18Molecules 2023, 28, x FOR PEER REVIEW 6 of 19 Figure 2. Tolerance studies by transepidermal water loss (TEWL): (A) Bursera graveolens essential oil; (B) Dacryodes peruviana essential oil; (C) Mespilodaphne quixos essential oil; (D) Melaleuca armillaris es- sential oil. Statistically significant differences: ** = p < 0.01; *** = p < 0.001; ns = not significant. 2.5. Efficacy Studies: Antifungal Activity The Minimum Inhibitory Concentrations (MICs) of essential oil from Bursera graveo- lens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris are shown in Table 3. All the essential oils presented antifungal activity against the three Candida strains. Dacryodes peruviana essential oil showed the lowest MIC value, and therefore it has greater antifungal activity. On the contrary, the essential oil with minor efficacy was Melaleuca armillaris essential oil. Table 3. Antifungal activity of essential oils from Bursera graveolens (BGR), Dacryodes peruviana (DPE), Mespilodaphne quixos (MQU), and Melaleuca armillaris (MAR). MIC (µg/mL) Candida albicans Candida glabrata Candida parapsilosis Amphotericin B 0.15 0.60 0.30 BGR 524.06 262.03 524.06 DPE 132.13 32.98 65.96 MQU 273.69 273.69 136.84 MAR 565.81 565.81 565.81 Blank - - - 2.6. In Vivo Anti-Inflammatory Activity 2.6.1. Arachidonic Acid (AA)-Induced Mouse Ear Edema Topical application of AA on the mice’s ears caused immediate erythema followed by the development of edema represented by the increase in the ear thickness as a result of the inflammatory process. However, this parameter decreased notably after topical treatment with the different essential oils tested mainly with Dacryodes peruviana (DPE) Figure 2. Tolerance studies by transepidermal water loss (TEWL): (A) Bursera graveolens essential oil; (B) Dacryodes peruviana essential oil; (C) Mespilodaphne quixos essential oil; (D) Melaleuca armillaris essential oil. Statistically significant differenc s: ** = < 0.01; *** = p < 0.001; ns = not signific nt. 2.5. Efficacy Studies: Antifungal Activity The Minimum Inhibitory Concentrations (MICs) of essential oil from Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris are shown in Table 3. All the ess ntial oils presented antifungal activity against the thr e Candida strains. Dacryodes peruvi na ess ntial oil showed the lowest MIC value, and ther fore it has g eater antifungal activity. On the contrary, the essential oil with minor efficacy was Melaleuca armillaris essential oil. Table 3. Antifungal activity of essential oils from Bursera graveolens (BGR), Dacryodes peruviana (DPE), Mespilodaphne quixos (MQU), and Melaleuca armillaris (MAR). MIC (µg/mL) Candida albicans Candida glabrata Candida parapsilosis Amphotericin B 0.15 0.60 0.30 BGR 524.06 262.03 524.06 DPE 132.13 32.98 65.96 MQU 273.69 273.69 136.84 MAR 565.81 565.81 565.81 Blank - - - 2.6. In Vivo Anti-Inflammatory Activity 2.6.1. Arachidonic Acid (AA)-Induced Mouse Ear Edema Topical application of AA on the mice’s ears caused immediate erythema followed by the development of edema represented by the increase in the ear thickness as a result of the inflammatory process. However, this parameter decreased notably after topical treatment with the different essential oils tested mainly with Dacryodes peruviana (DPE) Molecules 2023, 28, 5903 7 of 18 and Melaleuca armillaris (MAR), which decreased edema by 53.3% and 65.25%, respectively, although without reaching the efficacy of the reference drug (ibuprofen) that inhibits edema by 81.25%. The blank solution did not cause changes in the inflammatory process induced by AA (Figure 3). Molecules 2023, 28, x FOR PEER REVIEW 7 of 19 and Melaleuca armillaris (MAR), which decreased edema by 53.3% and 65.25%, respectively, although without reaching the efficacy of the reference drug (ibuprofen) that inhibits edema by 81.25%. The blank solution did not cause changes in the inflammatory process induced by AA (Figure 3). Figure 3. Anti-inflammatory efficacy after AA-induced mouse ear edema. Mean ± SD (n = 3). Ibu- profen gel = treatment with reference drug; Blank = Transcutol P:water; treatment with Bursera grav- eolens (BGR), Dacryodes peruviana (DPE), Mespilodaphne quixos (MQU), and Melaleuca armillaris (MAR). 2.6.2. Pro-Inflammatory Cytokines Determination The positive control showed a significant increase in the expression of pro-inflamma- tory cytokines TNF-α, IL-8, IL-17A, and IL-23 by the inflammation triggered by skin ap- plication of AA. When compared with the positive control, topical treatment with Bursera graveolens essential oil significantly decreased the expression of IL-8, IL-17A, and IL-23, whereas Mespilodaphne quixos essential oil reduced the expression of IL-17A and IL-23. Essential oils from Dacryodes peruviana (DPE) and Melaleuca armillaris (MAR) significantly reduced the expression of all pro-inflammatory cytokines studied TNF-α, IL-8, IL-17A, and IL-23. These results suggest that these essential oils could regulate the inflammatory processes and serve as a treatment or adjuvant in anti-inflammatory therapies (Figure 4). A B Figure 3. Anti-inflammatory efficacy after AA-induced mouse ear edema. Mean ± SD (n = 3). Ibuprofen gel = treatment with reference drug; Blank = Transcutol P:water; treatment with Burs- era graveolens (BGR), Dacryodes peruviana (DPE), Mespilodaphne quixos (MQU), and Melaleuca armil- laris (MAR). 2.6.2. Pro-Inflammatory Cytokines Determination The positive control showed a significant increase in the expression of pro-inflammatory cytokines TNF-α, IL-8, IL-17A, and IL-23 by the inflammation triggered by skin application of AA. When compared with the positive control, topical treatment with Bursera graveolens essential oil significantly decreased the expression of IL-8, IL-17A, and IL-23, whereas Mespilodaphne quixos essential oil reduced the expression of IL-17A and IL-23. Essential oils from Dacryodes peruviana (DPE) and Melaleuca armillaris (MAR) significantly reduced the expression of all pro-inflammatory cytokines studied TNF-α, IL-8, IL-17A, and IL-23. These results suggest that these essential oils could regulate the inflammatory processes and serve as a treatment or adjuvant in anti-inflammatory therapies (Figure 4). Molecules 2023, 28, x FOR PEER REVIEW 7 of 19 and Melaleuca armillaris (MAR), which decreased edema by 53.3% and 65.25%, respectively, although without reaching t e efficacy of the reference drug (ibuprofen) that inhibits edema by 81.25%. The blank solution did not cause changes in the inflammatory process induced by AA (Fig re 3). Figure 3. Anti-inflammatory efficacy after AA-induced mouse ear edema. Mean ± SD (n = 3). Ibu- profen gel = treat ent with referenc drug; Blank = Tran cutol P:water; tr tment with Bursera grav- eolens (BGR), Dacryodes peruviana (DPE), Mespilodaphne quixos (MQU), and Melaleuc armillaris (MAR). 2.6.2. Pro-Inflammatory Cytokines Determination The positive control showed a significant increase in the expression of pro-inflamma- tory cytokines TNF-α, IL-8, IL-17A, and IL-23 by the inflammati triggered by skin ap- plication of AA. When compared with the positive control, topical treatment with Bursera grave lens essential il significantly decreased the expression of IL-8, IL-17A, and IL-23, wherea Mespil daphne quixos ess nti l oil reduced the expression of IL-17A and IL-23. Essential oils from Dacryode peruviana (DPE) and Melaleuca armillaris (M R) significantly reduced the expression of all pro-inflammatory cytokines studied TNF-α, IL-8, IL-17A, an IL-23. Th e results suggest that these essential oils could regulate the inflammatory processes and serve as a treatment or adjuvant in anti-inflammatory therapies (Figure 4). A B Figure 4. Cont. Molecules 2023, 28, 5903 8 of 18Molecules 023, 28, x FOR PEER REVIEW 8 of 19 C D Figure 4. Relative expression of pro-inflammatory cytokines measured by quantitative reverse tran- scription polymerase chain reaction: (A) TNFα = Tumor necrosis factor-alpha; (B) IL–8 = interleukin– 8; (C) IL–17A = interleukin–17A; (D) IL-23 = interleukin–23. Control − = negative control; Control + = positive control; Ibuprofen gel = treatment with reference drug; Blank = Transcutol P:water; treat- ment with Bursera graveolens (BGR), Dacryodes peruviana (DPE), Mespilodaphne quixos (MQU) and Me- laleuca armillaris (MAR). Statistically significant differences: * = p < 0.05; ** = p < 0.01; *** = p < 0.001; ns = not significant. 3. Discussion Essential oils are a complex mixture of aromatic substances, which have shown sev- eral pharmacological properties thanks to their various components [44,45]. The uses at- tributed to essential oils include antiseptic, irritant, spasmolytic, sedative, anti-inflamma- tory, and antimicrobial potential [2,44,46]. The antimicrobial activity is of great interest because of the phenomenon of resistance to conventional antimicrobial drugs [47]. Specif- ically, in the present study, the essential oils obtained from four different plants: Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris were studied physically, chemically, and microbiologically to establish their possible pharmacological use in the treatment of both cutaneous candidiasis and dermal inflammation. The yields of essential oils obtained from these species are suitable for various industrial applications, including pharmacological use. High yields were observed for the essential oils of Bursera graveolens, Dacryodes peruviana, and Mespilodaphne quixos with values greater than 10 mL/Kg. In comparison, the yield for the essential oil of Melaleuca armillaris was intermedi- ate, with values between 5 mL/Kg and 10 mL/Kg [42]. Chemical characterization showed that the main compounds for the essential oils of Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris are limonene, α-phellandrene, (E)-methyl cinnamate, and 1,8-cineole, respectively. In previ- ous studies carried out on the essential oils of these species, similar compounds were found, although with different percentages. For example, limonene was the main com- pound in essential oil isolated from the fruits of Bursera graveolens, with percentages from 43.6% [26] to 49.89% [27]. In the essential oil of fruits of Dacryodes peruviana, α-phellan- drene (52.4%) and limonene (22.5%) were determined as the major compounds [46]. In essential oil extracted from the leaves of Mespilodaphne quixos, the main components were β-caryophyllene (15.1%) and cinnamyl acetate (11.4%) [48]; however, in a study on the variability of the chemical composition of this essential oil with the amount of shade, type of soil and altitude, it was determined that there is a great variation in the percentages of the major compounds (E)-cinnamyl acetate (5.96– 41.65%), (E)-methyl cinnamate (0.38– 37.91%), and trans-caryophyllene (8.77–37.02%) [49]. In the essential oil extracted from Figure 4. Relative expression of pro-inflammatory cytokines measured by quantitative reverse tran- scription polymerase chain reaction: (A) TNFα = Tumor necrosis factor-alpha; (B) IL–8 = interleukin–8; (C) IL–17A = interleukin–17A; (D) IL-23 = interleukin–23. Control − = negative control; Control + = positive control; Ibuprofen gel = treatment with reference drug; Blank = Transcutol P:water; treatment with Bursera graveolens (BGR), Dacryodes peruviana (DPE), Mespilodaphne quixos (MQU) and Melaleuca armillaris (MAR). Statistically significant differences: * = p < 0.05; ** = p < 0.01; *** = p < 0.001; ns = not significant. 3. Discussion Essential oils are a complex mixture of aromatic substances, which have shown several pharmacological properties thanks to their various components [44,45]. The uses attributed to essential oils include antiseptic, irritant, spasmolytic, sedative, anti-inflammatory, and antimicrobial potential [2,44,46]. The antimicrobial activity is of great interest because of the phenomenon of resistance to conventional antimicrobial drugs [47]. Specifically, in the present study, the essential oils obtained from four different plants: Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris were studied physically, chemically, and microbiologically to establish their possible pharmacological use in the treatment of both cutaneous candidiasis and dermal inflammation. The yields of essential oils obtained from these species are suitable for various industrial applications, including pharmacological use. High yields were observed for the essential oils of Bursera graveolens, Dacryodes peruviana, and Mespilodaphne quixos with values greater than 10 mL/kg. In comparison, the yield for the essential oil of Melaleuca armillaris was intermediate, with values between 5 mL/kg and 10 mL/kg [42]. Chemical characterization showed that the main compounds for the essential oils of Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris are limonene, α-phellandrene, (E)-methyl cinnamate, and 1,8-cineole, respectively. In previous studies carried out on the essential oils of these species, similar compounds were found, although with different percentages. For example, limonene was the main compound in essential oil isolated from the fruits of Bursera graveolens, with percent- ages from 43.6% [26] to 49.89% [27]. In the essential oil of fruits of Dacryodes peruviana, α-phellandrene (52.4%) and limonene (22.5%) were determined as the major compounds [46]. In essential oil extracted from the leaves of Mespilodaphne quixos, the main components were β-caryophyllene (15.1%) and cinnamyl acetate (11.4%) [48]; however, in a study on the variability of the chemical composition of thi ssential oil wit the amount of shade, type f soil and altitude, it was determined t at there is a great variation in the percent- ages of the major compounds (E)-cinn myl acetate (5.96–41.65%), (E)-methyl cinnamate (0.38–37.91%), and trans-caryophyllene (8.77–37.02%) [49]. In the essential oil ex racted Molecules 2023, 28, 5903 9 of 18 from leaves of Melaleuca armillaris, the 1,8-cineole was determined as the main component with percentages from 68.9% [50] to 85.8% [40]. To evaluate the tolerability of these essential oils for topical application on the skin, in vitro and in vivo were performed. In vitro models allowed for screening the toxicity of substances prior to in vivo assessment. Cell lines are highly used for toxicity screening in a living system because they are generally easy to cultivate, fast to grow, and sensitive to toxic irritation [51]. In this study, the results confirmed that the essential oils at the tested dilutions do not induce relevant cytotoxic effects, and thus they have high biocompatibility with human keratinocytes. This result was confirmed by further studies in volunteers by evaluation of the transepidermal water loss (TEWL) parameter, which allows for the evaluation of the skin barrier’s integrity after exposure to physical or chemical agents. TEWL is a biomechanical parameter of the skin that indicates water loss across the stratum corneum. Its determination is a noninvasive in vivo valuable method in dermatology to detect disturbances of the skin barrier in early stages, even before they become visible. In damaged skin, TEWL increases, and subsequently, the hydration declines, causing cracks and fissures in the stratum corneum [51]. As a general result, the essential oils studied did not cause skin irritation in the volunteers indicating biocompatibility and suitability for human use. Bursera graveolens essential oil did not cause significant differences in TEWL value after skin application compared with the basal state, whereas a significant reduction in TEWL after 10 min of skin application of Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris essential oils was observed but with a tendency to return to the basal states after 2 h of the experiment. These results suggest an enhancement of the hydration level of stratum corneum, probably due to the occlusive effect of these essential oils. Regarding antifungal activity, all the essential oils were effective against Candida albicans, Candida glabrata, and Candida parapsilosis. Essential oils from Bursera morelensis belonging to the same family as Bursera graveolens, have shown an antifungal effect, specifi- cally on Candida albicans [52]. In addition, previous studies have reported the antifungal activity of Bursera graveolens essential oil against Candida albicans [53]. Likewise, it has been shown that this essential oil could enhance the antifungal effect of drugs such as ampho- tericin B, improving its activity against various strains of Candida [2]. Dacryodes peruviana essential oil showed the lowest MIC value, and therefore it has greater antifungal activity. The antifungal activity of Bursera graveolens and Dacryodes peruviana essential oil could be due to its rich content in limonene and α-phellandrene. Specifically, Bursera graveolens essential oil showed the highest content in limonene (49.4 ± 2.2%) and Dacryodes peruviana essential oil showed the highest content of α-phellandrene (50.3 ± 3.3%). Studies have shown that limonene exhibits various biological effects, including excellent anti-Candida activity [54]. It is considered that the antifungal activity of this compound against Candida could be due to failure of ion transshipment and ATP generation in the membrane; dis- ruption of intracellular ion homeostasis; and extensive leakage of intracellular substance caused by potential, permeability, and integrity of the cell membrane. In addition, limonene also leads to suppression or intracellular metabolic disorders in Candida [55,56]. On the other hand, the activity exerted by α-phellandrene could be because this molecule dis- rupts the integrity of the fungal cell membrane, causing leakage of potassium ions and cell constituents, which would trigger an increase in total lipid content, extracellular pH, and membrane permeability, causing the death of the fungus [57]. Additionally, it has been shown that the biotransformation of α-phellandrene to 5-p-menthene-1,2-diol would generate antifungal activity against Candida [58]. The effect of Dacryodes peruviana essential oil against candida is interesting since its antifungal effect has been demonstrated, but only against Trichophyton rubrum and Trichophyton mentagrophytes [29]. The antifungal effect of Mespilodaphne quixos essential oil has been reported in previous studies against Candida albicans and Saccharomyces cerevisiae [59]. This efficacy could be due to the synergy of the components of this essential oil, as well as its high content of (E)-methyl cinnamate (19.3 ± 1.3%) and trans-caryophyllene (15.8 ± 1.8%). Both components have shown an effect on Candida species [35,60]. However, their mechanism of action is not fully Molecules 2023, 28, 5903 10 of 18 elucidated, and more studies are necessary to establish the antifungal mechanism exerted against these pathogenic fungi [61]. Finally, Melaleuca armillaris essential oil showed higher MIC values than those found for Dacryodes peruviana and Mespilodaphne quixos essential oil and similar to those found for Bursera graveolens essential oil. However, an antifungal effect was observed against three Candida strains tested. Previous studies have reported the anti-Candida effect of essential oils obtained from various species of Melaleuca spp. [62]. The main component found in Melaleuca armillaris essential oil was 1,8-cineole (83.4 ± 2.5%). This component has demonstrated its antifungal effect against Candida albicans, either alone or in combination with other drugs [63–65]. More in-depth studies are necessary to determine the antifungal mechanism of action of this essential oil against Candida. Together, these results suggest that the four essential oils studied could be used as active antifungal components or enhancers of conventional drugs in treating cutaneous candidiasis. The anti-inflammatory potential of the studied essential oils was evaluated by an arachidonic acid (AA)-induced edema model in mouse ear. Previous studies have docu- mented the inflammatory response of mouse ears to topical AA, and research indicates that this reaction occurs as a result of AA metabolites being produced through both the cyclooxygenase and lipoxygenase pathways. Arachidonic acid can trigger various events of an inflammatory response, such as an increase in skin thickness and the release of several inflammatory mediators [66]. An increase in skin thickness is among the initial events observed during inflammation, suggesting the presence of edema, epidermal hy- perplasia, and increased vascular permeability [46]. In this study, topical applications of AA markedly increased the thickness of the ear skin of mice with respect to the basal state. Conversely, topical treatment with essential oils from Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris reduced this parameter by 25%, 53.3%, 33.42%, and 65.25%, respectively (Figure 3). These results were consistent with the biochemical studies, in which several pro-inflammatory cytokines, including TNF-α, IL-8, IL-17A, and IL-23, were evaluated by Quantitative reverse transcription polymerase chain reaction (RT-qPCR). An increase in the expression of cytokines TNF-α, IL-8, IL-17A, and IL-23 was observed in the positive control. However, this inflammatory response was counteracted by topical treatment of the studied essential oils, mainly Dacryodes peruviana and Melaleuca armillaris, which caused a decrease in the production of all studied cytokines (Figure 4A–D). On the other hand, Bursera graveolens essential oil reduced the expression of IL-8, IL-17A, and IL-23 (Figure 4B–D), whereas Mespilodaphne quixos essential oil reduced the expression of IL-17A and IL-23 (Figure 4C,D). The anti-inflammatory activity exhibited that these essential oils may be due to the major compounds present in them. Specifically, limonene, α-phellandrene, (E)-methyl cinnamate, and 1,8-cineole have been reported in previous studies for their role in regulat- ing the inflammatory process. Limonene has been suggested as a potential inductor for the production of the anti-inflammatory cytokine IL-10 and reduction in the expression of TNF-α, IL-1β, and IL-6 [67,68]. Studies have demonstrated the anti-inflammatory ef- fects of limonene in colitis, dermatitis, and lung inflammation caused by allergies [69,70]. α-phellandrene inhibits neutrophil migration toward the inflamed area and reduces cy- tokines expression induced by TNF-α. Some studies suggest the benefit of α-Phellandrene in inflammatory diseases, such as rheumatoid arthritis, osteoarthritis, and allergic con- ditions [71]. Regarding methyl cinnamate, reports of its anti-inflammatory activity are scarce, although potential anti-inflammatory applications against periodontal disease and related systemic conditions have been suggested [72]. Finally, published research has documented that the monoterpene 1,8-Cineol reduces the expression of cytokines such as IL-4 and IL-6 in bronchial epithelial cells, as well as influences immune cells, where decreased expression in TNF-α, IL-1β, and IL-6 from monocytes, and also decreased the expression of IL-4 and IL-5 from lymphocytes. Even in acne, 1,8-Cineol-containing leaf extracts suppress the expression of IL-1β and IL-6 [73]. The large number of scientific pub- lications that support the anti-inflammatory potential of α-phellandrene and 1,8-Cineol in the regulation of the inflammatory process and their promising application in the treatment Molecules 2023, 28, 5903 11 of 18 of different inflammatory diseases agree with the results obtained in this investigation, in which the two essential oils that showed greater efficacy correspond to the species Dacryodes peruviana and Melaleuca armillaris, which are mainly composed of these two components. Therefore, these results suggest that the studied essential oils could be used as alternative therapy or adjuvant to increase the efficacy of conventional therapies in the treatment of dermal inflammation. 4. Materials and Methods 4.1. Materials Helium was purchased from INDURA (Quito, Ecuador). The standard aliphatic hydrocarbons (C9–C25) were purchased from ChemService (West Chester, PA, USA). Anhy- drous sodium sulfate and dichloromethane (DCM) were purchased from Sigma-Aldrich (San Luis, MO, USA). All chemicals were of analytical grade and used without further purification. Amphotericin B was obtained from Acofarma (Barcelona, Spain), RPMI- 1640 medium, MOPS, glucose, and chloramphenicol were obtained from Sigma-Aldrish (Darmstadt, Germany). Three yeast species were used for the assay: Candida albicans ATCC 10231, Candida glabrata ATCC 66032, and Candida parapsilosis ATCC 22019. 4.2. Plant Material The information on the collection of the four species is shown in Table 4. The species Mespilodaphne quixos and Melaleuca armillaris were collected in the vegetative stage. Three samples were collected. After being collected, the plant material was stored and transferred in airtight plastic containers (without refrigeration). The botanical specimens were iden- tified by Dr. Nixón Cumbicus at the herbarium of the Universidad Técnica Particular de Loja (HUTPL). A voucher specimen is preserved in the HUTPL. Table 4. Location and collection conditions of plant species. Species Plant Part Ambient Conditions Parish Canton Province Coordinates Altitude (m a.s.l.) T (◦C) P(atm) Latitude Longitude Bursera graveolens Fruits 26 0.98 Garza Real Zapotillo Loja 4 ◦19′13′′ S 80◦17′58′′ W 150 Dacryodes peruviana Fruits 25 0.89 La Paz Yacuambi Zamora Chinchipe 3 ◦40′13′′ S 78◦54′21′′ W 1025 Mespilodaphne quixos Leaves 24 0.91 Pano Tena Napo 1 ◦01′12′′ S 77◦51′57′′ W 650 Melaleuca armillaris Leaves 29 0.79 Guayllabamba Quito Pichincha 0 ◦04′43′′ S 78◦20′59′′ W 2171 T: temperature; P: pressure; a.s.l: above sea level. 4.3. Essential Oil Isolation The plant material of Bursera graveolens (10 Kg), Dacryodes peruviana (9 kg), Mespilo- daphne quixos (15 Kg), and Melaleuca armillaris (18 Kg) were processed fresh immediately after arriving at the laboratory, between 2 and 6 h after being collected. Extraction of the es- sential oil was carried out by hydrodistillation in Clevenger-type apparatus (80 L distiller). Initially, 16 L of water was placed in the distiller, then the plant material and the extraction process began [74]. The process was maintained for 3 h. The essential oil was separated from the water by decantation, dried using anhydrous sodium sulfate, and stored at 4 ◦C until being used in analysis. Each plant species was distilled three times. 4.4. Determination of Physical Properties of Essential Oil The density of the essential oils was determined using the ISO 279:1998 standard [75] (equivalent to the AFNOR NF T 75-111 standard) using an analytical balance (Mettler AC 100, Molecules 2023, 28, 5903 12 of 18 Mettler Toledo, Columbus, OH, USA). The refractive index was determined using the standard ISO 280:1998 [76] (similarly to AFNOR NF T 75-112) using a refractometer (model ABBE, BOECO, Hamburg, Germany). The optical rotation of essential oils was determined according to the standard ISO 592:1998 [77] using an automatic polarimeter (Mrc-P810, MRC, Holon, Israel). The procedures were carried out in triplicate, and all measurements were performed at 20 ◦C. 4.5. Essential Oil Compounds Identification 4.5.1. Quantitative Analysis The quantitative analysis was performed using gas chromatography coupled to flame ionization detector (GC-FID) for which an Agilent gas chromatograph (GC) (6890N series), a flame ionization detector (FID), a nonpolar GC column (DB-5ms, stationary phase 5%-phenyl-methylpolyxilosane, 30 m of length, 0.25 mm of diameter, and 0.25 µm of stationary layer thickness), and an automatic injector (7683 automatic liquid sampler) were used (all equipment was from Agilent Technologies, Santa Clara, CA, USA). The procedures were carried out as described by Valarezo et al. [49]. Briefly, 1 µL of solution (1/100, v/v, EO/DCM) was injected with a split ratio of 1:50. Helium was used as a carrier gas at 1 mL/min in constant flow mode and an average velocity of 25 cm/s. The injector and detector temperatures were 250 ◦C. The oven temperature program included an initial isotherm of 50 ◦C for 3 min, followed by a temperature ramp to 260 ◦C at 3 ◦C/min, and a final isotherm for 3 min. The relative amounts of the compounds were calculated based on the GC peak area (FID response) without using a correction factor. 4.5.2. Qualitative Analysis The quantitative analysis was performed using gas chromatography coupled to mass spectrometry (GC-MS) for which the same equipment as in the quantitative analysis was used, except for the detector that was replaced by a mass spectrometer (MS) (quadrupole) detector (series 5973 inert, Agilent Technologies, Santa Clara, CA, USA). The procedures were carried out as described by Valarezo et al. [49]. The sample concentration and tem- peratures (ramp, injector, and detector) were the same as for qualitative analyses. Helium was used as a carrier gas at 0.9 mL/min in constant flow mode and an average velocity of 34 cm/s. For the identification of the compounds, the retention index IR and the mass spectra were compared with published data [43,78]. 4.6. Cytotoxicity Studies by Methylthiazolyldiphenyl-Tetrazolium Bromide (MTT) Method An in vitro MTT cytotoxicity assay was conducted using the HaCaT human ker- atinocyte cell line. The cells were adjusted to a concentration of 2 × 105 cells/mL and seeded in a 96-well plate for 24 h. They were cultured using Dubelcco’s Modified Eagle’s Medium (DMEM), which contained a high glucose level and buffered with 25 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid). The medium was supplemented with 1% non-essential amino acids, 100 U/mL penicillin, 100 µg/mL streptomycin, and 10% heat-inactivated Fetal Bovine Serum (FBS). Following the incubation period, the cells were exposed to various dilutions of the essential oils from 500 to 5000 µg/mL using the culture medium as a dilution agent for 24 h. Subsequently, the HaCaT cells underwent a gentle washing process using 1% sterile PBS, followed by incubation with a solution of MTT (Sigma-Aldrich Chemical Co, St. Louis, MO, USA) at a concentration of 2.5 mg/mL for 2 h at 37 ◦C. After carefully removing the medium, a solubilization reagent (99% DMSO) was added in a volume of 0.1 mL to facilitate cell lysis and dissolve the purple MTT crystals. Cell viability was assessed at a wavelength of 570 nm using a microplate photometer, Varioskan TM LUX (Thermo Scientific, Waltham, MA, USA). In order to make a com- parative analysis, a negative control (untreated HaCaT cells) was concurrently processed using the same method. This experiment was carried out in triplicate. The results were Molecules 2023, 28, 5903 13 of 18 expressed as a percentage of cell survival relative to the negative control (100% viability) using Equation (1): %Cell viability = Abs sample Abs control × 100 (1) 4.7. In Vivo Tolerance Studies Transepidermal water loss (TEWL) measurements were conducted on the ventral area of the forearm in 10 volunteers (aged between 20 and 40 years) who had healthy skin. The participants provided their written informed consent prior to the study. The research protocol received approval from the Ethics Committee of the University of Barcelona (IRB00003099), adhering to the principles of the Declaration of Helsinki. Each essential oil from the four species was diluted to 5% using 55% Transcutol-P and 40% water. TEWL values were determined at basal state and 10 min, 1 h, and 2 h after skin application of essential oils using a Tewameter TM HEX (Courage & Khazaka Electronics GmbH, Cologne, Germany). The probe was pressed on the skin for 20 s, and the results are presented in units of g/cm2/h. 4.8. Antifungal Efficacy Studies 4.8.1. Preparation of Culture Medium A total of 5.20 g of RPMI 1640 medium powder was dissolved in 150 mL of distilled wa- ter. Subsequently, 17.26 g of MOPS buffer and 9 g of glucose were added until 250 mL was obtained. The culture medium was adjusted to pH 7.0 with 0.1 M NaOH, and 500 µg/mL chloramphenicol was added and passed through a 0.22-micron filter. 4.8.2. Inoculum Preparation The Candida strains were plated on Sabouraud agar for 48 h at 30 ◦C. A second replant- ing of 24 h was then carried out. Isolated colonies (approximately four) were resuspended in Ringer’s solution by vortexing to about 0.5 McFarland turbidity. A standard was pre- pared separately by adding 0.5 mL of solution A (1.175% w/v BaCl2.2H2O) and 99.50 mL of solution B (1% H2SO4), which were taken to a spectrophotometer and measured at 530 nm. The absorbance should be between 0.120 and 0.150. The colony suspension was adjusted by performing a 1/10 dilution with Ringer’s medium until obtaining an absorbance similar to our standard. The final suspension would be close to 0.5–2.5 × 105 CFU/mL. Assays were as in EUCAST Assays Definitive Document EDef 7.1: A Method for Determination of Broth Dilution MICs of Antifungal Agents for Fermentative Yeasts [79]. 4.8.3. Antifungal Activity In a 96-well plate, 100 µL of the culture medium (mentioned in Section 4.8.1) was added (in each well). Subsequently, in the first well of the first two rows (vertically), a previously dissolved solution of Amphotericin B was added to a final concentration of 150 µg/mL (this drug was used as standard). In the following wells (first well vertically), the samples to be tested were added: Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris essential oils (dissolved at 5% with 55% Transcutol P and 40% water), and serial doubling dilutions were made (horizontally). Finally, 100 µL of the inoculum was added to all the wells. The culture medium without inoculum and without drug was used as blank, and the inoculum was used as the negative control. MIC was determined by spectrophotometry using a model 680 microplate reader spectrophotometer (Bio-Rad, Madrid, Spain) at a wavelength of 620 nm. The plates were read at t0 and then at 24 h and 48 h after incubation at 30 ◦C [79]. 4.9. In Vivo Anti-Inflammatory Activity: Arachidonic Acid (AA)-Induced Edema 4.9.1. Study Protocol In vivo experiments were conducted in accordance with the ethical protocol approved by the Bioethics Committee of the University of Barcelona (CEEA/UB ref. 4/16 and Molecules 2023, 28, 5903 14 of 18 Generalitat ref. 8756. Date: 28 January 2016). Male BALB/c mice aged 4–5 months old were used for the study. A solution of 60 µL of AA at 5 mg/mL diluted in PBS was topically applied to the right ears to induce inflammation. Ear thickness was measured before and 15 after the induction of inflammation using a micrometer. A group of inflamed animals (n = 3) served as a positive control, whereas a group of untreated mice (n = 3) was used as a negative group to compare the results. After 20 min of inducing inflammation, four groups of animals (n = 3) were topically treated with 60 µL of Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris essential oils (dissolved at 5% with 55% Transcutol P and 40% water), respectively. In parallel, a group (n = 3) was treated with a commercial anti-inflammatory product (60 mg of ibuprofen gel 50 mg/g; reference: 886,192.7), and a last group (referred to as the Blank group) was treated with Transcutol- P:water (60:40, v/v). After 20 min of these treatments, ear thickness was again measured, and the animals were euthanized by cervical dislocation. Oedema was expressed as the difference between the basal ear thickness and the ear thickness after AA application. The inhibition of inflammation percentage or anti-inflammatory efficacy was calculated based on the decrease in ear thickness after each treatment. Finally, the right ears were cut to evaluate the expression of pro-inflammatory cytokines. 4.9.2. Time Quantitative PCR to Assay Inflammatory Biomarkers Small portions of mouse ear tissue were disrupted using a Bead Beater homogenizer (MP Biomedicals, Madrid, Spain) and the TRI-Reagent® solution (Sigma Aldrich, St. Louis, MO, USA), a phenol-based reagent (named as TRIzol). Total RNA was extracted following the manufacturer’s protocol. Integrity and total amount of RNA were tested by Nan- oDrop One spectrophotometer (Thermo Scientific, Waltham, MA, USA). Then, 500 ng of RNA was retrotranscribed into complementary DNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Finally, a dilution of 1/10 of cDNA was used to perform the RT-qPCR. Therefore, the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and specific pair of primers for inflamma- tory genes (IL-8, IL-17A, IL-23, and TNFα) were added to the reaction. As a housekeeping gene, the GAPDH was selected and used for normalization. Relative changes in gene expression were analyzed by applying the 2−∆∆Ct method. Table 5 shows the primers used for the Real-Time qPCR. Table 5. Gene-specific primers used in the Real-Time qPCR. Gene Primer Sequence (5′ to 3′) GAPDH FW: AGCTTGTCATCAACGGGAAG RV: TTTGATGTTAGTGGGGTCTCG IL-8 FW: GCTGTGACCCTCTCTGTGAAG RV: CAAACTCCATCTTGTTGTGTC IL-23 FW: GAGCCTTCTCTGCTCCCTGATA RV: GACTGAGGCTTGGAATCTGCTG IL-17A FW: TTTTCAGCAAGGAATGTGGA RV: TTCATTGTGGAGGGCAGAC TNFα FW: AACTAGTGGTGCCAGCCGAT RV: CTTCACAGAGCAATGACTCC GAPDH = Glyceraldehyde-3-Phosphate Dehydrogenase; IL-8 = interleukin-8; IL-23 = interleukin-23; IL-17A = interleukin-17A; TNFα = Tumor necrosis factor alpha; FW = forward primer; and RV = reverse primer. 4.10. Statistical Analysis The results were presented as mean ± SD. Statistical analysis was carried out using GraphPad Prism, version 6.0 software (GraphPad Software Inc., San Diego, CA, USA). One- way ANOVA, followed by Tukey’s test, was used to compare the mean values. Statistical significance was set at a p value less than 0.05. Molecules 2023, 28, 5903 15 of 18 5. Conclusions In conclusion, this study demonstrates through its different experiments that the essential oils obtained from Bursera graveolens, Dacryodes peruviana, Mespilodaphne quixos, and Melaleuca armillaris can be topically used in dermal treatments as they exhibited high biocompatibility with human keratinocytes as well as an occlusive effect on the skin of healthy volunteers, improving hydration without causing irritation or damage to the in- tegrity of the stratum corneum. Additionally, these essential oils showed antifungal activity against Candida albicans, Candida glabrata, and Candida parapsilosis, possibly thanks to their rich content in limonene, α-phellandrene, (E)-methyl cinnamate, and 1,8-cineole, respec- tively. Similarly, these essential oils effectively counteracted and alleviated two critical events in dermal inflammatory processes, such as edema and the overexpression of pro- inflammatory cytokines, including TNF-α, IL-8, IL-17A, and IL-23. The pharmacological potential of these essential oils suggests that they could be used both as active antifungal and anti-inflammatory components or adjuvants to increase the efficacy of conventional therapies in the treatment of both cutaneous candidiasis and dermal inflammation. Author Contributions: Conceptualization, L.S., L.C.E. and M.M.; methodology, N.B., M.R. and L.B.; formal analysis, A.C.; investigation, E.V., M.-J.F. and L.C.E.; data curation, L.C.E.; writing—original draft preparation, E.V., L.S. and L.C.E.; writing—review and editing, L.C.E. and M.M.; supervision, A.C.; project administration, M.M. All authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding. Institutional Review Board Statement: The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board (or Ethics Committee) of the University of Barcelona (IRB00003099, dated 30 January 2019) and Bioethics Committee of the University of Barcelona (CEEA/UB ref. 4/16 and Generalitat ref. 8756. Date: 28 January 2016). Informed Consent Statement: Informed consent was obtained from all subjects involved in the study. Data Availability Statement: Data are contained within the article. Acknowledgments: L.C.E. acknowledges the support of the Secretaría de Educación Superior, Cien- cia, Tecnología e Innovación (SENESCYT—Ecuador). Conflicts of Interest: The authors declare no conflict of interest. References 1. Sanchez, D.A.; Schairer, D.; Tuckman-Vernon, C.; Chouake, J.; Kutner, A.; Makdisi, J.; Friedman, J.M.; Nosanchuk, J.D.; Friedman, A.J. Amphotericin B releasing nanoparticle topical treatment of Candida spp. in the setting of a burn wound. Nanomed. Nanotechnol. Biol. Med. 2014, 10, 269–277. [CrossRef] 2. Espinoza, L.C.; Sosa, L.; Granda, P.C.; Bozal, N.; Díaz-Garrido, N.; Chulca-Torres, B.; Calpena, A.C. Development of a Topical Amphotericin B and Bursera graveolens Essential Oil-Loaded Gel for the Treatment of Dermal Candidiasis. Pharmaceuticals 2021, 14, 1033. [PubMed] 3. Hussein, M.; Wong, L.J.M.; Zhao, J.; Rees, V.E.; Allobawi, R.; Sharma, R.; Rao, G.G.; Baker, M.; Li, J.; Velkov, T. Unique mechanistic insights into pathways associated with the synergistic activity of polymyxin B and caspofungin against multidrug-resistant Klebsiella pneumoniae. Comput. Struct. Biotechnol. J. 2022, 20, 1077–1087. [CrossRef] [PubMed] 4. Ben-Ami, R. Treatment of Invasive Candidiasis: A Narrative Review. J. Fungi 2018, 4, 97. 5. Hassan, Y.; Chew, S.Y.; Than, L.T.L. Candida glabrata: Pathogenicity and Resistance Mechanisms for Adaptation and Survival. J. Fungi 2021, 7, 667. 6. Kawai, A.; Yamagishi, Y.; Mikamo, H. In vitro efficacy of liposomal amphotericin B, micafungin and fluconazole against non-albicans Candida species biofilms. J. Infect. Chemother. 2015, 21, 647–653. [CrossRef] 7. Branco, J.; Miranda, I.M.; Rodrigues, A.G. Candida parapsilosis Virulence and Antifungal Resistance Mechanisms: A Comprehen- sive Review of Key Determinants. J. Fungi 2023, 9, 80. 8. Pérez-González, N.; Espinoza, L.C.; Rincón, M.; Sosa, L.; Mallandrich, M.; Suñer-Carbó, J.; Bozal-de Febrer, N.; Calpena, A.C.; Clares-Naveros, B. Gel Formulations with an Echinocandin for Cutaneous Candidiasis: The Influence of Azone and Transcutol on Biopharmaceutical Features. Gels 2023, 9, 308. 9. Sosa, L.; Calpena, A.C.; Silva-Abreu, M.; Espinoza, L.C.; Rincón, M.; Bozal, N.; Domenech, O.; Rodríguez-Lagunas, M.J.; Clares, B. Thermoreversible Gel-Loaded Amphotericin B for the Treatment of Dermal and Vaginal Candidiasis. Pharmaceutics 2019, 11, 312. Molecules 2023, 28, 5903 16 of 18 10. Gündel, S.d.S.; de Godoi, S.N.; Santos, R.C.V.; da Silva, J.T.; Leite, L.B.d.M.; Amaral, A.C.; Ourique, A.F. In vivo antifungal activity of nanoemulsions containing eucalyptus or lemongrass essential oils in murine model of vulvovaginal candidiasis. J. Drug Deliv. Sci. Technol. 2020, 57, 101762. [CrossRef] 11. Margraf, A.; Perretti, M. Immune Cell Plasticity in Inflammation: Insights into Description and Regulation of Immune Cell Phenotypes. Cells 2022, 11, 1824. 12. Mosser, D.M.; Edwards, J.P. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 2008, 8, 958–969. [CrossRef] [PubMed] 13. Espinoza, L.C.; Vera-García, R.; Silva-Abreu, M.; Domènech, Ò.; Badia, J.; Rodríguez-Lagunas, M.J.; Clares, B.; Calpena, A.C. Topical Pioglitazone Nanoformulation for the Treatment of Atopic Dermatitis: Design, Characterization and Efficacy in Hairless Mouse Model. Pharmaceutics 2020, 12, 255. [PubMed] 14. Parameswaran, N.; Patial, S. Tumor necrosis factor-α signaling in macrophages. Crit. Rev. Eukaryot. Gene Expr. 2010, 20, 87–103. [CrossRef] [PubMed] 15. Hoover, L.; Bochicchio, G.V.; Napolitano, L.M.; Joshi, M.; Bochicchio, K.; Meyer, W.; Scalea, T.M. Systemic inflammatory response syndrome and nosocomial infection in trauma. J. Trauma 2006, 61, 310–316; discussion 316–317. [CrossRef] [PubMed] 16. Fossiez, F.; Djossou, O.; Chomarat, P.; Flores-Romo, L.; Ait-Yahia, S.; Maat, C.; Pin, J.J.; Garrone, P.; Garcia, E.; Saeland, S.; et al. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J. Exp. Med. 1996, 183, 2593–2603. [CrossRef] 17. Chan, T.C.; Hawkes, J.E.; Krueger, J.G. Interleukin 23 in the skin: Role in psoriasis pathogenesis and selective interleukin 23 blockade as treatment. Ther. Adv. Chronic Dis. 2018, 9, 111–119. [CrossRef] 18. Whelton, A. Nephrotoxicity of nonsteroidal anti-inflammatory drugs: Physiologic foundations and clinical implications. Am. J. Med. 1999, 106, 13s–24s. [CrossRef] 19. Sriuttha, P.; Sirichanchuen, B.; Permsuwan, U. Hepatotoxicity of Nonsteroidal Anti-Inflammatory Drugs: A Systematic Review of Randomized Controlled Trials. Int. J. Hepatol. 2018, 2018, 5253623. [CrossRef] 20. Zuo, X.; Gu, Y.; Wang, C.; Zhang, J.; Zhang, J.; Wang, G.; Wang, F. A Systematic Review of the Anti-Inflammatory and Immunomodulatory Properties of 16 Essential Oils of Herbs. Evid.-Based Complement. Altern. Med. Ecam 2020, 2020, 8878927. [CrossRef] 21. Nakatsu, T.; Lupo, A.T.; Chinn, J.W.; Kang, R.K.L. Biological activity of essential oils and their constituents. In Studies in Natural Products Chemistry; Atta-ur, R., Ed.; Elsevier: Amsterdam, The Netherlands, 2000; Volume 21, pp. 571–631. 22. Sharmeen, J.B.; Mahomoodally, F.M.; Zengin, G.; Maggi, F. Essential Oils as Natural Sources of Fragrance Compounds for Cosmetics and Cosmeceuticals. Molecules 2021, 26, 666. [CrossRef] [PubMed] 23. Pandey, A.K.; Kumar, P.; Saxena, M.J.; Maurya, P. Distribution of aromatic plants in the world and their properties. In Feed Additives; Florou-Paneri, P., Christaki, E., Giannenas, I., Eds.; Academic Press: Cambridge, MA, USA, 2020; Chapter 6; pp. 89–114. 24. The Plant List. Burseraceae. Available online: http://www.theplantlist.org (accessed on 3 July 2020). 25. Jørgesen, P.M.; León-Yáñez, S. Catalogue of the Vascular Plants of Ecuador. Available online: http://legacy.tropicos.org/ ProjectAdvSearch.aspx?projectid=2 (accessed on 11 July 2020). 26. Viteri Jumbo, L.O.; Corrêa, M.J.M.; Gomes, J.M.; González Armijos, M.J.; Valarezo, E.; Mantilla-Afanador, J.G.; Machado, F.P.; Rocha, L.; Aguiar, R.W.S.; Oliveira, E.E. Potential of Bursera graveolens essential oil for controlling bean weevil infestations: Toxicity, repellence, and action targets. Ind. Crops Prod. 2022, 178, 114611. [CrossRef] 27. Rey-Valeirón, C.; Guzmán, L.; Saa, L.R.; López-Vargas, J.; Valarezo, E. Acaricidal activity of essential oils of Bursera grave- olens (Kunth) Triana & Planch and Schinus molle L. on unengorged larvae of cattle tick Rhipicephalus (Boophilus) microplus (Acari:Ixodidae). J. Essent. Oil Res. 2017, 29, 344–350. [CrossRef] 28. Torre, L.d.l.; Navarrete, H.; Muriel, M.P.; Macía Barco, M.J.; Balslev, H. Enciclopedia de las Plantas Útiles del Ecuador; Herbario QCA de la Escuela de Ciencias Biológicas de la Pontificia Universidad Católica del Ecuador and Herbario AAU del Departamento de Ciencias Biológicas de la Universidad de Aarhus: Quito, Ecuador; Aarhus, Danmark, 2008. 29. Valarezo, E.; Ojeda-Riascos, S.; Cartuche, L.; Andrade-González, N.; González-Sánchez, I.; Meneses, M.A. Extraction and Study of the Essential Oil of Copal (Dacryodes peruviana), an Amazonian Fruit with the Highest Yield Worldwide. Plants 2020, 9, 1658. 30. The Plant List. Lauraceae. Available online: http://www.theplantlist.org/1.1/browse/A/Piperaceae/ (accessed on 4 July 2022). 31. Encyclopædia Britannica. Lauraceae. Available online: https://www.britannica.com/plant/Meliaceae (accessed on 3 July 2021). 32. Trofimov, D.; de Moraes, P.L.R.; Rohwer, J.G. Towards a phylogenetic classification of the Ocotea complex (Lauraceae): Classifica- tion principles and reinstatement of Mespilodaphne. Bot. J. Linn. Soc. 2019, 190, 25–50. [CrossRef] 33. Palacios, W. Árboles del Ecuador: Familias y Géneros; Ministerio del Ambiente del Ecuador-MAE: Quito, Ecuador, 2011. 34. Ballabeni, V.; Tognolini, M.; Giorgio, C.; Bertoni, S.; Bruni, R.; Barocelli, E. Ocotea quixos Lam. essential oil: In vitro and in vivo investigation on its anti-inflammatory properties. Fitoterapia 2010, 81, 289–295. [CrossRef] 35. Bruni, R.; Medici, A.; Andreotti, E.; Fantin, C.; Muzzoli, M.; Dehesa, M.; Romagnoli, C.; Sacchetti, G. Chemical composition and biological activities of Ishpingo essential oil, a traditional Ecuadorian spice from Ocotea quixos (Lam.) Kosterm. (Lauraceae) flower calices. Food Chem. 2004, 85, 415–421. [CrossRef] 36. Ballabeni, V.; Tognolini, M.; Bertoni, S.; Bruni, R.; Guerrini, A.; Rueda, G.M.; Barocelli, E. Antiplatelet and antithrombotic activities of essential oil from wild Ocotea quixos (Lam.) Kosterm. (Lauraceae) calices from Amazonian Ecuador. Pharmacol. Res. 2007, 55, 23–30. [CrossRef] Molecules 2023, 28, 5903 17 of 18 37. Scalvenzi, L.; Radice, M.; Toma, L.; Severini, F.; Boccolini, D.; Bella, A.; Guerrini, A.; Tacchini, M.; Sacchetti, G.; Chiurato, M.; et al. Larvicidal activity of Ocimum campechianum, Ocotea quixos and Piper aduncum essential oils against Aedes aegypti. Parasite 2019, 26, 23. [CrossRef] 38. Passos, B.G.; de Albuquerque, R.D.D.G.; Muñoz-Acevedo, A.; Echeverria, J.; Llaure-Mora, A.M.; Ganoza-Yupanqui, M.L.; Rocha, L. Essential oils from Ocotea species: Chemical variety, biological activities and geographic availability. Fitoterapia 2022, 156, 105065. [CrossRef] 39. WFO Plant List. Myrtaceae Juss. Available online: https://wfoplantlist.org/plant-list (accessed on 20 February 2023). 40. Chabir, N.; Romdhane, M.; Valentin, A.; Moukarzel, B.; Marzoug, H.N.B.; Brahim, N.B.; Mars, M.; Bouajila, J. Chemical Study and Antimalarial, Antioxidant, and Anticancer Activities of Melaleuca armillaris (Sol Ex Gateau) Sm Essential Oil. J. Med. Food 2011, 14, 1383–1388. [CrossRef] 41. Amri, I.; Mancini, E.; De Martino, L.; Marandino, A.; Lamia, H.; Mohsen, H.; Bassem, J.; Scognamiglio, M.; Reverchon, E.; De Feo, V. Chemical Composition and Biological Activities of the Essential Oils from Three Melaleuca Species Grown in Tunisia. Int. J. Mol. Sci. 2012, 13, 16580–16591. [CrossRef] [PubMed] 42. Molares, S.; González, S.B.; Ladio, A.; Agueda Castro, M. Etnobotánica, anatomía y caracterización físico-química del aceite esencial de Baccharis obovata Hook. et Arn. (Asteraceae: Astereae). Acta Bot. Bras. 2009, 23, 578–589. 43. Adams, R.P. Identification of Essential Oil Components by Gas Chromatography/Mass Spectrometry, 4th ed.; Allured Publishing Corporation: Carol Stream, IL, USA, 2007. 44. Soares, G.A.B.; Bhattacharya, T.; Chakrabarti, T.; Tagde, P.; Cavalu, S. Exploring Pharmacological Mechanisms of Essential Oils on the Central Nervous System. Plants 2022, 11, 21. 45. Mekonnen, A.; Tesfaye, S.; Christos, S.G.; Dires, K.; Zenebe, T.; Zegeye, N.; Shiferaw, Y.; Lulekal, E. Evaluation of Skin Irritation and Acute and Subacute Oral Toxicity of Lavandula angustifolia Essential Oils in Rabbit and Mice. J. Toxicol. 2019, 2019, 5979546. [CrossRef] 46. Espinoza, L.C.; Valarezo, E.; Fábrega, M.J.; Rodríguez-Lagunas, M.J.; Sosa, L.; Calpena, A.C.; Mallandrich, M. Characterization and In Vivo Anti-Inflammatory Efficacy of Copal (Dacryodes peruviana (Loes.) H.J. Lam) Essential Oil. Plants 2022, 11, 3104. 47. Cowen, L.E.; Sanglard, D.; Howard, S.J.; Rogers, P.D.; Perlin, D.S. Mechanisms of Antifungal Drug Resistance. Cold Spring Harb. Perspect. Med. 2014, 5, a019752. [CrossRef] 48. Sacchetti, G.; Guerrini, A.; Noriega, P.; Bianchi, A.; Bruni, R. Essential oil of wild Ocotea quixos (Lam.) Kosterm. (Lauraceae) leaves from Amazonian Ecuador. Flavour Fragr. J. 2006, 21, 674–676. [CrossRef] 49. Valarezo, E.; Vullien, A.; Conde-Rojas, D. Variability of the Chemical Composition of the Essential Oil from the Amazonian Ishpingo Species (Ocotea quixos). Molecules 2021, 26, 3961. [CrossRef] 50. Hayouni, E.A.; Bouix, M.; Abedrabba, M.; Leveau, J.-Y.; Hamdi, M. Mechanism of action of Melaleuca armillaris (Sol. Ex Gaertu) Sm. essential oil on six LAB strains as assessed by multiparametric flow cytometry and automated microtiter-based assay. Food Chem. 2008, 111, 707–718. [CrossRef] 51. Espinoza, L.C.; Silva-Abreu, M.; Calpena, A.C.; Rodriguez-Lagunas, M.J.; Fabrega, M.J.; Garduno-Ramirez, M.L.; Clares, B. Nanoemulsion strategy of pioglitazone for the treatment of skin inflammatory diseases. Nanomedicine 2019, 19, 115–125. [CrossRef] 52. Rivera-Yañez, C.R.; Terrazas, L.I.; Jimenez-Estrada, M.; Campos, J.E.; Flores-Ortiz, C.M.; Hernandez, L.B.; Cruz-Sanchez, T.; Garrido-Fariña, G.I.; Rodriguez-Monroy, M.A.; Canales-Martinez, M.M. Anti-Candida Activity of Bursera morelensis Ramirez Essential Oil and Two Compounds, α-Pinene and γ-Terpinene—An In Vitro Study. Molecules 2017, 22, 2095. [CrossRef] 53. Mendez, A.H.S.; Cornejo, C.G.F.; Coral, M.F.C.; Arnedo, M.C.A. Chemical Composition, Antimicrobial and Antioxidant Activities of the Essential Oil of Bursera graveolens (Burseraceae) From Perú. Indian J. Pharm. Educ. Res. 2017, 51, s429–s436. [CrossRef] 54. Yu, H.; Lin, Z.-X.; Xiang, W.-L.; Huang, M.; Tang, J.; Lu, Y.; Zhao, Q.-H.; Zhang, Q.; Rao, Y.; Liu, L. Antifungal activity and mechanism of d-limonene against foodborne opportunistic pathogen Candida tropicalis. Lwt 2022, 159, 113144. [CrossRef] 55. Thakre, A.; Zore, G.; Kodgire, S.; Kazi, R.; Mulange, S.; Patil, R.; Shelar, A.; Santhakumari, B.; Kulkarni, M.; Kharat, K.; et al. Limonene inhibits Candida albicans growth by inducing apoptosis. Med. Mycol. 2018, 56, 565–578. [CrossRef] 56. Zore, G.; Thakre, A.D.; Jadhav, S.; Karuppayil, S.M. Terpenoids inhibit Candida albicans growth by affecting membrane integrity and arrest of cell cycle. Phytomedicine Int. J. Phytother. Phytopharm. 2011, 18, 1181–1190. [CrossRef] 57. Zhang, J.H.; Sun, H.L.; Chen, S.Y.; Zeng, L.; Wang, T.T. Anti-fungal activity, mechanism studies on alpha-Phellandrene and Nonanal against Penicillium cyclopium. Bot. Stud. 2017, 58, 13. [CrossRef] 58. Thangaleela, S.; Sivamaruthi, B.S.; Kesika, P.; Tiyajamorn, T.; Bharathi, M.; Chaiyasut, C. A Narrative Review on the Bioactivity and Health Benefits of Alpha-Phellandrene. Sci. Pharm. 2022, 90, 57. [CrossRef] 59. Belletti, N.; Ndagijimana, M.; Sisto, C.; Guerzoni, M.E.; Lanciotti, R.; Gardini, F. Evaluation of the Antimicrobial Activity of Citrus Essences on Saccharomyces cerevisiae. J. Agric. Food Chem. 2004, 52, 6932–6938. [CrossRef] 60. Huang, Q.-S.; Zhu, Y.-J.; Li, H.-L.; Zhuang, J.-X.; Zhang, C.-L.; Zhou, J.-J.; Li, W.-G.; Chen, Q.-X. Inhibitory Effects of Methyl trans-Cinnamate on Mushroom Tyrosinase and Its Antimicrobial Activities. J. Agric. Food Chem. 2009, 57, 2565–2569. [CrossRef] 61. Ali, N.A.M.; Rahmani, M.; Shaari, K.; Ali, A.M.; Lian, G.E.C. Antimicrobial Activity of Cinnamomum impressicostatum and C. pubescens and Bioassay-Guided Isolation of Bioactive (E)-Methyl Cinnamate. J. Biol. Sci. 2010, 10, 101–106. [CrossRef] 62. Ruiz-Duran, J.; Torres, R.; Stashenko, E.E.; Ortiz, C. Antifungal and Antibiofilm Activity of Colombian Essential Oils against Different Candida Strains. Antibiotics 2023, 12, 668. [CrossRef] Molecules 2023, 28, 5903 18 of 18 63. Silva, R.A.d.; Antonieti, F.M.P.M.; Röder, D.V.D.d.B.; Pedroso, R.d.S. Essential Oils of Melaleuca, Citrus, Cupressus, and Litsea for the Management of Infections Caused by Candida Species: A Systematic Review. Pharmaceutics 2021, 13, 1700. [CrossRef] 64. de Macêdo, D.G.; de Almeida Souza, M.M.; Morais-Braga, M.F.B.; Coutinho, H.D.M.; dos Santos, A.T.L.; Machado, A.J.T.; Rodrigues, F.F.G.; da Costa, J.G.M.; de Menezes, I.R.A. Seasonality influence on the chemical composition and antifungal activity of Psidium myrtoides O. Berg. S. Afr. J. Bot. 2020, 128, 9–17. [CrossRef] 65. Hendry, E.R.; Worthington, T.; Conway, B.R.; Lambert, P.A. Antimicrobial efficacy of eucalyptus oil and 1,8-cineole alone and in combination with chlorhexidine digluconate against microorganisms grown in planktonic and biofilm cultures. J. Antimicrob. Chemother. 2009, 64, 1219–1225. [CrossRef] 66. Young, J.M.; Spires, D.A.; Bedord, C.J.; Wagner, B.; Ballaron, S.J.; de Young, L.M. The Mouse Ear Inflammatory Response to Topical Arachidonic Acid. J. Investig. Dermatol. 1984, 82, 367–371. [CrossRef] 67. Ku, C.M.; Lin, J.Y. Anti-inflammatory effects of 27 selected terpenoid compounds tested through modulating Th1/Th2 cytokine secretion profiles using murine primary splenocytes. Food Chem. 2013, 141, 1104–1113. [CrossRef] 68. Lappas, C.M.; Lappas, N.T. D-Limonene modulates T lymphocyte activity and viability. Cell Immunol. 2012, 279, 30–41. [CrossRef] 69. d’Alessio, P.A.; Mirshahi, M.; Bisson, J.-F.; Bene, M.C. Skin repair properties of dLimonene and perillyl alcohol in murine models. Anti-Inflammatory Anti-Allergy Agents. Med. Chem. 2014, 13, 29–35. 70. Hansen, J.S.; Norgaard, A.W.; Koponen, I.K.; Sorli, J.B.; Paidi, M.D.; Hansen, S.W.; Clausen, P.A.; Nielsen, G.D.; Wolkoff, P.; Larsen, S.T. Limonene and its ozone-initiated reaction products attenuate allergic lung inflammation in mice. J. Immunotoxicol. 2016, 13, 793–803. [CrossRef] 71. Valsalan Soba, S.; Babu, M.; Panonnummal, R. Ethosomal Gel Formulation of Alpha Phellandrene for the Transdermal Delivery in Gout. Adv. Pharm. Bull. 2021, 11, 137–149. [CrossRef] [PubMed] 72. Murakami, Y.; Kawata, A.; Suzuki, S.; Fujisawa, S. Cytotoxicity and Pro-/Anti-inflammatory Properties of Cinnamates, Acrylates and Methacrylates Against RAW264.7 Cells. In Vivo 2018, 32, 1309–1322. [CrossRef] 73. Pries, R.; Jeschke, S.; Leichtle, A.; Bruchhage, K.-L. Modes of Action of 1,8-Cineol in Infections and Inflammation. Metabolites 2023, 13, 751. [CrossRef] [PubMed] 74. de Elguea-Culebras, G.O.; Panamá-Tapia, L.A.; Melero-Bravo, E.; Cerro-Ibáñez, N.; Calvo-Martínez, A.; Sánchez-Vioque, R. Comparison of the phenolic composition and biological capacities of wastewater from Origanum vulgare L., Rosmarinus officinalis L., Salvia lavandulifolia Vahl. and Thymus mastichina L. resulting from two hydrodistillation systems: Clevenger and MAE. J. Appl. Res. Med. Aromat. Plants. 2023, 34, 100480. [CrossRef] 75. ISO 279:1998; Essential Oils-Determination of Relative Density at 20 ◦C—Reference Method. International Organization for Standardization (ISO): Geneva, Switzerland, 2020; pp. 1–4. 76. ISO 280:1998; Essential Oils-Determination of Refractive Index. International Organization for Standardization (ISO): Geneva, Switzerland, 2020; pp. 1–3. 77. ISO 592:1998; Essential Oils-Determination of Optical Rotation. International Organization for Standardization (ISO): Geneva, Switzerland, 2020; pp. 1–4. 78. van Den Dool, H.; Dec. Kratz, P. A generalization of the retention index system including linear temperature programmed gas—Liquid partition chromatography. J. Chromatogr. A 1963, 11, 463–471. [CrossRef] 79. Rodriguez-Tudela, J.L.; Arendrup, M.C.; Barchiesi, F.; Bille, J.; Chryssanthou, E.; Cuenca-Estrella, M.; Dannaoui, E.; Denning, D.W.; Donnelly, J.P.; Dromer, F.; et al. EUCAST Definitive Document EDef 7.1: Method for the determination of broth dilution MICs of antifungal agents for fermentative yeasts: Subcommittee on Antifungal Susceptibility Testing (AFST) of the ESCMID European Committee for Antimicrobial Susceptibility Testing (EUCAST)∗. Clin. Microbiol. Infect. 2008, 14, 398–405. [CrossRef] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.